Sign InSign Up

In vitro transcription of S. pyogenes Cas9 sgRNAs from two complementary oligos

Updated 1/6/2018 12:31 AM
Step-by-step
by Stephen Floor

Introduction

A protocol to in vitro transcribe sgRNAs from oligos for S. pyogenes Cas9.

Steps:

1) Order oligos

2) Anneal oligo, extend & amplify using PCR

3) Gel purify PCR products (optional)

4) Transcribe

5) Bead cleanup or gel purify RNA

Note that there are two G's inserted at the 5' end of all sgRNAs generated using this protocol that are outside the protospacer. These do not affect cleavage biochemically, and are trimmed inside cells if nucleofected as an RNP.

It's recommended to start with a 100µL transcription because the volumes are convenient and this is typically enough sgRNA. Scale up as needed.

References:

Lin & Staahl, eLife 2014.

RNA: A Laboratory Manual (CSHL Press) Changelog: 1.01 - added references 1.1 - added bead cleanup

Materials

  • Oligos
    • Phusion polymerase (or other high fidelity PCR polymerase)
      • T7 polymerase
        • We use homemade T7, but you can also use the Ambion MEGAshortscript kit (Thermo Fisher AM1354M)
      • Large gel apparatus
        • 10X transcription buffer
          • 300mM Tris-Cl pH 8.1
          • 250mM MgCl2
          • 0.1% Triton X-100
          • 20mM spermidine
          • 100mM DTT
        • 25mM ATP/CTP/GTP/UTP mix (pH 8.0)
          • Pyrophosphatase (Roche; optional but recommended)
            • RQ1 RNase-free DNase (Promega)
              • 2x Denaturing gel loading buffer
                • 95% deionized formamide
                • 20mM EDTA pH 8.0
                • Dye (I typically use Bromophenol blue, Xylene Cyanol and Orange G in this. None overlap with sgRNA)
              • 6x Agarose gel loading buffer
                • 25% Ficoll
                • Enough orange G so that the loading dye looks brighter than Orange Crush soda (~0.1%).
              • Gel extraction buffer
                • 1mM EDTA
                • 300mM NaOAc pH 5.2
                • 0.5 w/v SDS

              Procedure

              Designing oligo templates for sgRNAs

              1. Order two oligos that have ~20nt complementarity in the middle that span the guide RNA, with a T7 promoter at the 5' end. The sequence of the T7 promoter is TAATACGACTCACTATAGG. Note that the first two G's here are added onto the template.

              If your target sequence starts with G or GG, replace the GG at the end of the T7 promoter with the protospacer nucleotides.

              1. Oligo design - capital letters are the protospacer:
              1. Illustration of the sgRNA in context of a target:
              1. Oligo sequences:

              Top: 5' - TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAG - 3'

              Bottom: 5' - AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTATTTTAACTTGCTATTTCT - 3'

              sgRNA fwd primer: GGATCCTAATACGACTCACTATAG

              sgRNA rev primer: AAAAAAGCACCGACTCGG

              Note: only change the sequence of the protospacer (N's above). The bottom oligo and fwd/rev primers are always the same and only needs to be ordered once.

              Extend the oligos to a double-stranded DNA template by PCR (~1 hour)

              1. Resuspend oligos to 100µM

              x nmol oligo * 10 = ul ddH2O to add to yield 100µM

              1. Number of reactions:
              1. Set up two 100µL PCRs per sgRNA template. If just making one sgRNA or a small number, use the single-reaction setup. If making many, make the master mix and add 95µL of the master mix to each tube and 5µL of the sgRNA-specific top oligo.
              Table1
              A
              B
              C
              D
              1
              		ReagentVolume (ul) Master mix volume (ul) Number of reactions (2 * # of sgRNAs)
              2
              		5x HF buffer20442
              3
              		1 uM top oligo (sgRNA-specific)2-
              4
              		1 uM bottom oligo (always the same)24.4
              5
              		100 uM sgRNA fwd2
              6
              		100 uM sgRNA rev2
              7
              		dNTPs 24.4
              8
              		phusion polymerase12.2
              9
              		ddH2O69151.8
              1. Run a PCR with the following program:

              98 degrees for 2 minutes

              98 degrees for 30 seconds

              60 degrees for 30 seconds

              72 degrees for 30 seconds

              repeat for 30 cycles

              72 degrees for 1 minute

              4 degrees forever

              Analytical gel of the PCR(s) (~1 hour; ~2 hrs if gel purification required)

              1. Pour a 2% agarose gel with SYBR Safe dye and using orange G dye in the loading buffer.
              1. Load 5µL of each PCR and 5µL of the Lonza DNA Marker 50-1,000bp (50461)
              1. Run at ~100V until the orange G band is ~2/3rds through the gel
              1. Image the gel. If there is one major band around 100 nt, perform a PCR cleanup (Qiagen) and proceed directly to in vitro transcription. If there are multiple bands, pour a preparative 2% agarose gel(s) with comb large enough to hold the entire 200µL PCR volume, run the gel and gel purify (Qiagen)

              In vitro transcription (~5 hours to overnight)

              1. Prepare the transcription templates from above at ~100ng/µL or adjust the volume of template versus DEPC H2O in the table below. The amount of template is variable, and even 500 nanograms for a 100µL reaction should be plenty.
              1. Set up one of the reactions below depending on desired yield:

              NOTE: I typically do not add pyrophosphatase until the reaction starts turning cloudy (after 30 minutes to 1 hour). This is a positive control that the transcription is working, and the PPIase then stops accumulation of PPI

              CRITICALIt is important to keep all reagents on ice but set up the reaction at room temperature in the order indicated. Cold spermidine (in the transcription buffer) can precipitate the template DNA.

              Table2
              A
              B
              C
              D
              E
              F
              G
              H
              1
              		Reagent100 ul reaction1 ml reaction5 ml reactionFinal concentration
              2
              		10X transcription buffer101005001X
              3
              		DTT (1 M)2205020 mM
              4
              		25 mM A/C/G/U mix2020010005 mM
              5
              		Pyrophosphatase (Roche) 0.5151 ug/ml
              6
              		T7 polymerase10100500100 ug/ml
              7
              		Template (100 ng/ul) 101005001 uM
              8
              		DEPC H2O 49.54993 * 832 (2495)
              9
              10
              		Expected yield~50 micrograms~500 micrograms~2 mg
              11
              		Expected yield (sgRNA molarity)~15 ul of 100 uM~150 ul of 100 uM> 500 ul of 100 uM
              1. Incubate in a water bath or air incubator at 37 degrees for 5 hours to overnight.

              It is not recommended to use a heat block since the temperature fluctuates too much (and may exceed 37).

              1. After 5 hours (or overnight for possibly higher yield) of transcription, add 1µL RQ1 RNase-free DNase per 100µL of transcription and continue to incubate at 37 degrees for 30 minutes.
              1. End the transcription by adding half transcription volume of 2x denaturing loading dye (e.g. 50µL for a 100µL transcription).

              Using this reduced amount of loading dye facilitates loading more RNA into a gel and is sufficient to denature short RNAs.

              PAUSERNA is stable in denaturing loading dye overnight if necessary - immediate purification is advised.

              Cleanup option #1: bead cleanup (much faster, may purify truncated products or nucleotides)

              1. CRITICALIncubate RNAclean or homemade SPRI beads at room temperature for ~1 hour to bring to RT
              1. Add 900µL 100% EtOH to the transcription

              this and all steps below assume a 100µL transcription. Scale up accordingly if using a larger transcription

              1. Add 500µL SPRI beads
              1. immediately pipet ten times to mix
              1. Incubate 5 minutes at room temperature
              1. Move tube to magnetic stand for five minutes or until clear
              1. Aspirate supernatant without disturbing beads
              1. Keep tube on magnet, add 1mL 80% EtOH

              note: use freshly prepared 80% EtOH as it is hygroscopic

              1. Wait 1 minute
              1. Aspirate wash
              1. Repeat wash steps for a total of three washes
              1. Remove any residual ethanol
              1. Air dry pellet on magnet for 5-10 minutes
              1. Remove from magnetic rack
              1. Add 50µL water
              1. Pipet 5 times to mix
              1. Return to magnetic rack, wait until clear
              1. Transfer supernatant to new tube - this contains your RNA
              1. It is recommended to measure the concentration of this using a qubit

              Cleanup option #2: Gel purify transcribed RNA (more difficult, higher purity)

              1. Pour a 7M urea, 10% 29:1 polyacrylamide denaturing gel of sufficient size to hold all of the transcription(s)
              1. Run gel until the xylene band is midway through the gel (a few hours)
              1. Image gel using UV shadowing to visualize band. Band should be just above the xylene.
              1. Excise gel slice with razor blade and place in eppendorf tube (small txn) or conical tube (large txn)
              1. Crush gel slice with a P1000 tip or glass rod
              1. Add enough gel elution buffer to cover gel bits so they can move around when rocked (typically ~500µL per 100µL transcription).
              1. Freeze the resuspended gel bits for 30 minutes on dry ice or at -80 degrees

              This fractures the gel bits and increases yield.

              1. PAUSERock overnight at 4 degrees
              1. For small scale transcription, filter the gel bits through a 0.45 micron filter. Use a P-1000 tip with the end cut off using a razor blade to collect all the gel bits into the filter.

              NOTE: the SDS may precipitate during this process, especially if left on ice. If so, repeat filtration using a new filter.

              1. For large scale transcription, vortex the gel bits and pour all of it onto a flip-top conical tube filter. Allow to vacuum filter until no more drops are retained.
              1. Ethanol precipitate the RNA by adding 1/1000 volumes glycoblue and 2.5 volumes 100% ethanol.
              1. Incubate at -80 for at least 1 hour but note that RNA under EtOH is stable for months at -80.
              1. Spin down at 16k g (small-scale) or 5k g (large-scale) for 25 minutes at 4 degrees.

              For large-scale transcription, resuspend the pellet from above in 500µL of -20 degree 100% EtOH and transfer to a microfuge tube. The pellet will remain chunky - collect all the chunks with more ethanol if needed. Spin again at 16k g for 5 minutes to re-pellet.

              1. Aspirate supernatant and discard, being careful not to dislodge pellet.
              1. Wash pellet with 500µL -20 degree 70% ethanol.

              CRITICALPipet the 70% ethanol gently not onto the pellet. Keep the tube cold to avoid resuspending the RNA in the 70% ethanol.

              1. Spin at 16k g for 5 minutes at 4 degrees.
              1. Aspirate supernatant carefully and discard
              1. Quick spin in tabletop centrifuge
              1. Aspirate remaining ethanol and discard
              1. Air dry at room temperature for 5 minutes with the tube cap open
              1. Resuspend pellet in ~30µL DEPC H2O per 100µL transcription and quantify using nanodrop or qubit.

              Comments

              gilbertronic
              10/9/2018 03:45 PM
              Hi Stephen, thanks for posting this great protocol :) One question, I have found some other sgRNA scaffold sequences that differ by one bp from yours. Specifically, in the region of the sgRNA scaffold encoded on the top oligo in your protocol seems to have one fewer A here compared to other sources (i.e. the capitalised base here 5'-gttttagagctagaaatagcaagttaaaataAg-3'). Is this a deliberate change? Does it have any consequence? Cheers, Charlie
              Benchling
              Learn More
              Contact
              • Contact Us
              • 680 Folsom St, 8th Floor
                San Francisco, CA 94107
              Legal

              Benchling is actively tested against the latest versions of Chrome, Firefox, Safari, and Edge. It doesn't look like your current browser is supported - for more information, click here.