Designing oligo templates for sgRNAs

1. Order two oligos that have ~20nt complementarity in the middle that span the guide RNA, with a T7 promoter at the 5' end. The sequence of the T7 promoter is TAATACGACTCACTATAGG. Note that the first two G's here are added onto the template.

If your target sequence starts with G or GG, replace the GG at the end of the T7 promoter with the protospacer nucleotides.

2. Oligo design - capital letters are the protospacer:

3. Illustration of the sgRNA in context of a target:

4. Oligo sequences:

Top: 5' - TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAG - 3'

Bottom: 5' - AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTATTTTAACTTGCTATTTCT - 3'

sgRNA fwd primer: GGATCCTAATACGACTCACTATAG

sgRNA rev primer: AAAAAAGCACCGACTCGG

Note: only change the sequence of the protospacer (N's above). The bottom oligo and fwd/rev primers are always the same and only needs to be ordered once.

Extend the oligos to a double-stranded DNA template by PCR (~1 hour)

5. Resuspend oligos to 100µM

x nmol oligo * 10 = ul ddH₂O to add to yield 100µM

6. Number of reactions:

7. Set up two 100µL PCRs per sgRNA template. If just making one sgRNA or a small number, use the single-reaction setup. If making many, make the master mix and add 95µL of the master mix to each tube and 5µL of the sgRNA-specific top oligo.

8. Run a PCR with the following program:

98 degrees for 2 minutes

98 degrees for 30 seconds

60 degrees for 30 seconds

72 degrees for 30 seconds

repeat for 30 cycles

72 degrees for 1 minute

4 degrees forever

Analytical gel of the PCR(s) (~1 hour; ~2 hrs if gel purification required)

9. Pour a 2% agarose gel with SYBR Safe dye and using orange G dye in the loading buffer.

10. Load 5µL of each PCR and 5µL of the Lonza DNA Marker 50-1,000bp (50461)

11. Run at ~100V until the orange G band is ~2/3rds through the gel

12. Image the gel. If there is one major band around 100 nt, perform a PCR cleanup (Qiagen) and proceed directly to in vitro transcription. If there are multiple bands, pour a preparative 2% agarose gel(s) with comb large enough to hold the entire 200µL PCR volume, run the gel and gel purify (Qiagen)

In vitro transcription (~5 hours to overnight)

13. Prepare the transcription templates from above at ~100ng/µL or adjust the volume of template versus DEPC H₂O in the table below. The amount of template is variable, and even 500 nanograms for a 100µL reaction should be plenty.

14. Set up one of the reactions below depending on desired yield:

NOTE: I typically do not add pyrophosphatase until the reaction starts turning cloudy (after 30 minutes to 1 hour). This is a positive control that the transcription is working, and the PPIase then stops accumulation of PPI

CRITICALIt is important to keep all reagents on ice but set up the reaction at room temperature in the order indicated. Cold spermidine (in the transcription buffer) can precipitate the template DNA.

15. Incubate in a water bath or air incubator at 37 degrees for 5 hours to overnight.

It is not recommended to use a heat block since the temperature fluctuates too much (and may exceed 37).

16. After 5 hours (or overnight for possibly higher yield) of transcription, add 1µL RQ1 RNase-free DNase per 100µL of transcription and continue to incubate at 37 degrees for 30 minutes.

17. End the transcription by adding half transcription volume of 2x denaturing loading dye (e.g. 50µL for a 100µL transcription).

Using this reduced amount of loading dye facilitates loading more RNA into a gel and is sufficient to denature short RNAs.

PAUSERNA is stable in denaturing loading dye overnight if necessary - immediate purification is advised.

Cleanup option #1: bead cleanup (much faster, may purify truncated products or nucleotides)

18. CRITICALIncubate RNAclean or homemade SPRI beads at room temperature for ~1 hour to bring to RT

19. Add 900µL 100% EtOH to the transcription

this and all steps below assume a 100µL transcription. Scale up accordingly if using a larger transcription

20. Add 500µL SPRI beads

21. immediately pipet ten times to mix

22. Incubate 5 minutes at room temperature

23. Move tube to magnetic stand for five minutes or until clear

24. Aspirate supernatant without disturbing beads

25. Keep tube on magnet, add 1mL 80% EtOH

note: use freshly prepared 80% EtOH as it is hygroscopic

26. Wait 1 minute

27. Aspirate wash

28. Repeat wash steps for a total of three washes

29. Remove any residual ethanol

30. Air dry pellet on magnet for 5-10 minutes

31. Remove from magnetic rack

32. Add 50µL water

33. Pipet 5 times to mix

34. Return to magnetic rack, wait until clear

35. Transfer supernatant to new tube - this contains your RNA

36. It is recommended to measure the concentration of this using a qubit

Cleanup option #2: Gel purify transcribed RNA (more difficult, higher purity)

37. Pour a 7M urea, 10% 29:1 polyacrylamide denaturing gel of sufficient size to hold all of the transcription(s)

38. Run gel until the xylene band is midway through the gel (a few hours)

39. Image gel using UV shadowing to visualize band. Band should be just above the xylene.

40. Excise gel slice with razor blade and place in eppendorf tube (small txn) or conical tube (large txn)

41. Crush gel slice with a P₁₀₀₀ tip or glass rod

42. Add enough gel elution buffer to cover gel bits so they can move around when rocked (typically ~500µL per 100µL transcription).

43. Freeze the resuspended gel bits for 30 minutes on dry ice or at -80 degrees

This fractures the gel bits and increases yield.

44. PAUSERock overnight at 4 degrees

45. For small scale transcription, filter the gel bits through a 0.45 micron filter. Use a P-1000 tip with the end cut off using a razor blade to collect all the gel bits into the filter.

NOTE: the SDS may precipitate during this process, especially if left on ice. If so, repeat filtration using a new filter.

46. For large scale transcription, vortex the gel bits and pour all of it onto a flip-top conical tube filter. Allow to vacuum filter until no more drops are retained.

47. Ethanol precipitate the RNA by adding 1/1000 volumes glycoblue and 2.5 volumes 100% ethanol.

48. Incubate at -80 for at least 1 hour but note that RNA under EtOH is stable for months at -80.

49. Spin down at 16k g (small-scale) or 5k g (large-scale) for 25 minutes at 4 degrees.

For large-scale transcription, resuspend the pellet from above in 500µL of -20 degree 100% EtOH and transfer to a microfuge tube. The pellet will remain chunky - collect all the chunks with more ethanol if needed. Spin again at 16k g for 5 minutes to re-pellet.

50. Aspirate supernatant and discard, being careful not to dislodge pellet.

51. Wash pellet with 500µL -20 degree 70% ethanol.

CRITICALPipet the 70% ethanol gently not onto the pellet. Keep the tube cold to avoid resuspending the RNA in the 70% ethanol.

52. Spin at 16k g for 5 minutes at 4 degrees.

53. Aspirate supernatant carefully and discard

54. Quick spin in tabletop centrifuge

55. Aspirate remaining ethanol and discard

56. Air dry at room temperature for 5 minutes with the tube cap open

57. Resuspend pellet in ~30µL DEPC H₂O per 100µL transcription and quantify using nanodrop or qubit.