Left overlap | 20bp SDS | Right overlap |
ctgggagctgcgattggcag | NNNNNNNNNNNNNNNNNNNN | gttttagagctagaaatagc |
Step B-1 and Step B-2 can be done concurrently.
We generally digest overnight 8-12 hours or so to reduce background
DO NOT PCR PURIFY. DO NOT PHOSPHATASE TREAT. These will reduce your efficiency and do little to reduce your background and may even make it higher relative to your successful product.
Note, this is not necessary if you are only cloning a single gRNA oligo but not amplifying first will reduce your efficiency
3'gRNA-extender gactagccttattttaacttgctatttctagctctaaaac
5'gRNA-extender tcgcggctgggaacgaaactctgggagctgcgattggcag
Please note I DO NOT DO PCR CLEANUP. I use the PCR product directly in Gibson assembly.
Please DO NOT FORGET TO DILUTE THE EXONUCLEASE first while prepping your Gibson Mixes. Do not attempt to pippete exactly .64µL as the original protocol says. I pipette 6.4 of my diluted exo. Using too little or too much exo both cause a reduction in efficiency.
Benchling is actively tested against the latest versions of Chrome, Firefox, Safari, and Edge. It doesn't look like your current browser is supported - for more information, click here.