Part 1: Harvest cells

1. At least three days post-transfection, harvest cells and wash 2X with PBS.

Part 2: Isolate the genomic DNA

2. One option is to use the Agencourt DNAdvance Genomic DNA Isolation Kit (Beckman Coulter). We typically use 200 μL of lysis buffer with 20,000 to 100,000 cells.

Another option is to resuspend 60,000 to 100,000 cells in 100 μL of genomic extraction buffer (10mM tris pH 7.5, 0.05% SDS, 25 μg/mL proteinase K), incubate at 37°C for 1 h, then heat inactivate at 80°C for 20 m.

Part 3: PCR amplify the genomic loci of interest

3. Primer pairs should be designed such that the protospacer is as close to the middle of the amplicon as possible, with the amplicon length being 200-300bp in length. For new amplicons it is suggested that you design and order multiple pairs in case one does not work.

An example of a primer pair:

EMX1 HTS forward: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNCAGCTCAGCCTGAGTGTTGA

EMX1 HTS reverse: TGGAGTTCAGACGTGTGCTCTTCCGATCTCTCGTGGGTTTGTGGTTGC

4. Test each primer pair for genomic DNA PCR amplification. Phusion High-Fidelity DNA Polymerase works well:

5. Run the PCR according to the manufacturer’s instructions using an annealing temperature of 62°C, an extension time of 15 s, and 34 rounds of amplification.

6. Run a small amount of each reaction on a 2% agarose gel and assess for genomic DNA amplification.

Keep in mind the Illumina adaptor sequences overall add 66bp to your amplicon length. There should be minimal to no off-target bands or primer dimer bands in the PCR product mixture.

7. Once you have identified a primer pair that works, run a quantitative PCR to determine the optimal gDNA template amount and cycle number for your genomic loci of interest.

This can be done by adding Sybr Green to the PCR mixture listed in Step 6 and running the same PCR program on a qPCR machine.

It is advisable to try multiple samples, each with a different amount of gDNA template. Chose the sample with the lowest C(t) value. Use this amount of gDNA and a cycle number equal to the C(t) value plus two for your future PCR reactions. This ensures that your PCR will stop in the linear range of amplification, minimizing PCR bias.

8. Run your gDNA PCR using the PCR mixture and program listed in Step 6 with the gDNA amount and amplification number determined from Step 7.

9. Run an analytical 2% agarose gel with all of your samples to ensure the PCR worked.

It is also advisable to run a non-template control.

10. The resulting PCR products should be purified using RapidTips and then quantified using a Quanti-iT PicoGreen dsDNA Assay.

Part 4: Run a second round of PCR to add Illumina barcodes to each of your samples

11. A protocol that works well for this PCR is as follows:

12. Run the PCR according to the manufacturer’s instructions using an annealing temperature of 61°C, an extension time of 40 s, and 6 rounds of amplification.

Part 5: Combine samples

13. Now that the samples have unique barcode sets, they can be combined. Combine 2-5 μL of all samples of similar lengths (within 50bp of each other) together.

14. Gel purify the resulting pooled samples on a 2% agarose gel and combine all gel purified samples together.

Part 6: Quantify the resulting library a Quanti-iT PicoGreen dsDNA Assay

15. ake a portion of this library and dilute it to 4nM.

16. Quantify this diluted library using a KAPA Library Quantification Kit-Illumina.

Part 7: Sequence the quantified library on an Illumina MiSeq.