Materials
- 2X Q5 Hot Start Master Mix (NEB M0494S)
- 10X CutSmart buffer (shipped with most NEB enzymes)
- Ampure XP beads (Beckman A63880)
- DNA Clean and Concentrator Columns (Zymo Research D4004)
- Oligo Binding Buffer (Zymo Research D4060-1)
- Dialysis discs (Millipore VSWP04700)
- GelStar Nucleic Acid Stain (Lonza 50535)
- Reagents for 15% TBE-PAGE minigels using e.g. Bio-Rad Mini-Protean apparatus.
Notes
All DNA purifications are using DNA Clean and Concentrator columns unless otherwise specified. In some cases (to maintain very small fragments), two volumes of Zymo Oligo Binding Buffer is used in place of DNA Binding Buffer included in DNA Clean and Concentrator kits. Samples can be stored at -20˚C between steps if necessary.
Linker preparation
All linkers should be ordered from IDT as oligonucleotides. For Linkers 1 and 3, PAGE purification is required. Phosphorylation is using T4 PNK (NEB) as per manufacturer’s protocol where specified. Annealing is carried out in 1X CutSmart buffer in a PCR machine that is set to ramp from 98˚C to 20˚C over 60 minutes. All completed adapters should be drop-dialyzed against ddH2O for 20 minutes before use using a dialysis disc.
Linker 1 provides the MmeI site that is used to trim future-sgRNAs to 20 nt when ligated to digested/blunted input DNA. It's designed with a few additional features:
● Linker 1 is double-ended so that it doesn't matter which end ligates to the blunted DNA fragments
● There is an internal ScrFI site (to break up concatamers after ligation) and internal BsaXI sites (to remove Linker 1 so it can be replaced by Linker 3, the sgRNA body, near the end of the protocol). Blunt-end concatamers also generate an AclI site which is also exploited to break up concatamers.
Click here to see the full sequence in Benchling.
Linker 1 - FWD: 5' GTTGGATAGTGTACTGCGGCTCCATAGACTAGCTCAGGACCAGGATCTTAGATAGTAATCAACAGCCCCTCCTAATTCCAAC 3'
Linker 2 - REV: 3' GTTGGAATTAGGAGGGGCTGTTGATTACTATCTAAGATCCTGGTCCTGAGCTAGTCTATGGAGCCGCAGTACACTATCCAAC 5'
Preparation:
Phosphorylate each oligo separately using T4 PNK, then anneal. Heat inactivate T4 PNK.
●
Linker 2 provides the promoter sequence used to transcribe the final sgRNA. In principle this could be replaced with any promoter sequence for your system, or could be replaced with sequence that facilitates cloning into a vector which itself provides a promoter sequence.
● It's blunt and unphosphorylated on the "left" end. This minimizes ligation to other fragments in the reaction mixture.
● The "top" strand has a two nucleotide 3' overhang; the identities of these two nucleotides are randomized so that they anneal to the two nucleotide 3' overhang produced by MmeI digestion of input DNA. Those two nucleotides become the first two nucleotides of the sgRNA protospacer (i.e. sgRNA 20mer variable region).
● The 5' end of the bottom strand is phosphorylated before annealing to the top strand.
Linker 2 - Top: 5’ gaaatTAATACGACTCACTATAGNN 3’
Linker 2 - Bottom: 3’ ctttaATTATGCTGAGTGATATC 5’
T7 RNA Polymerase promoter
Click here to see the full sequence in Benchling
Preparation:
Phosphorylate “bottom” oligonucleotide only. Heat-inactivate T4 PNK and anneal to “top” oligo.
Linker 3 provides the sgRNA "body" sequence that folds to complex with Cas9.
● It has a 3' overhang on the "left" end which is complementary to the overhang left when BsaXI digestion removes Linker 1. The right end is blunt.
● The "top" strand is phosphorylated and the bottom strand is unphosphorylated to favor unidirectional ligation.
Linker 3 - Top: 5’ TAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCAGGTCGGTGCTTTTTTT 3’
Linker 3 - Btm: 3’ CAAATTCTCGATACGACCTTTGTCGTATCGTTCAAATTTATTCCGATCAGGCAATAGTTGAACTTTTTCACCGTGGCTCAGCCACGAAAAAAA 5’
Preparation:
Phosphorylate “top” oligonucleotide only. Heat-inactivate T4 PNK and anneal to “bottom” oligo.
EATING Library Construction
- Dephosphorylating sheared DNA ends
Skip this step if your input is a set of pooled PCR products.
In a PCR tube, combine the following:
| 10 µl | Input DNA at ~1µg/µl (or a minimum of ~3 µg) |
| 5 µl | 10X CutSmart Buffer |
| 30 µl | dH2O |
| 1 µl | rSAP |
Incubate at 37˚C for 30 minutes. Heat inactivate at 65˚C for 10 minutes. Recover a 1µL sample; label it 1. This reduces the incidence of broken DNA ligating to adapters in subsequent steps.
- Exposing PAM-adjacent sequences: Split into 3 PCR tubes. Add the following to each tube:
| 1.5 µl | HpaII (15U) |
| 1.5 µl | ScrFI (7.5U) |
| 1.5 µl | BfaI (15U) |
Incubate for ~1hr at 37˚C.
Heat inactivate enzymes, 20 min at 80˚C.
Purify over 1 column each using two volumes of Oligo Binding Buffer, eluting in 8µL each.
Oligo Binding Buffer is used here so that even very short fragments are retained (<25bp). Using regular DNA purification buffer loses most fragments under 100bp.
- Blunting:
Note that this step differs from the published protocol. We have found that these modified conditions and low temperature maximize the yield of correctly blunted fragments.
Pool the DNA purifications from the previous step. Measure the concentration.
In a PCR tube, prepare the following:
| Component | Quantity |
| DNA | 2 µg |
| 20 mM MgCl2 | 10 µl |
| 10X Mung Bean Nuclease Buffer | 5 µl |
| 100 mM NaAc pH 5.0 | 10 µl |
| ddH2O | q.s. 50 µl |
In a separate tube, prepare a master mix of the following, scaling to the number of library preps being carried out:
Note that Promega Mung Bean Nuclease differs in activity from batch to batch; the activity is printed on the label. Use this information to calculate the volume required. For example, if supplied at 95U/µL use 0.64µL for 60U per reaction.
| Component | Quantity |
| 10X Mung Bean Nuclease Buffer | 1 µl |
| 20 mM MgCl2 | 2 µl |
| 100 mM NaAc pH 5.0 | 2µl |
| Mung Bean Nuclease | 60 U |
| dd H2O | q.s. 10 µl |
⚠ Critical! Place the tubes containing DNA into a PCR machine set to 5°C. Add 5µL of the Mung Bean Nuclease mix. It is important not to let the DNA and Mung Bean Nuclease mix at room temperature.
Incubate for 10 minutes at 5°C in the PCR machine.
Add 70µL 0.04% SDS to the reaction to stop MBN digestion.
Transfer to a 1.5mL tube and add 60µL (2 volumes) Oligo Binding Buffer and 240µL (8 volumes) 100% ethanol. Split over two Zymo columns and elute in 10µL each. Nanodrop and recover a 0.5µL sample; label it 2.
- Linker 1 ligation:
Dialyze sample against ddH2O on dialysis disc for 20 minutes to fully desalt and improve blunt ligation efficiency.
Use dialyzed, phosphorylated MmeI linker (Linker 1).
| Component | Quantity |
| DNA (about 1 to 1.5µg; equivalent to 10-15 pmol ends at 300bp) | 17 µl |
| Linker 1 (at 100 pmol/µl) | 1 µl |
| 2X Quick Ligation Buffer | 18 µl |
| Quick Ligase | 0.5 µl |
Incubate for 30 minutes at RT. (Longer leads to high-molecular-weight products that result in poor recovery from column).
Add 200µL (5 volumes) Zymo DNA binding buffer. Split across 2 Zymo columns and elute in 10µL each. Measure and recover a 0.5µL sample; label it 3.
- Linker 1 deconcatamerization
| Component | Quantity |
| DNA | 18 µl |
| 10X CutSmart | 2.2 µl |
| ScrFI | 1 µl |
| AclI | 1 µl |
Incubate at 37˚C for 30 minutes. Take a sample; label it 4.
These enzymes digest tandem adapter products into a ~40bp size that’s convenient to remove by Ampure selection.
- Linker 1 fragment removal:
Adjust to 50µL using 1X Cutsmart (i.e., add 28µL). Add 1.2 volumes (60µL) Ampure XP beads. Collect on magnet; wash x2 with fresh 70% EtOH; dry and elute in 10µL ddH2O. Expect ~10ng/µL. Take a 0.25µL sample; label it 5.
- MmeI digestion:
| 9 µl | DNA |
| 1.3 µl | 10X Cutsmart |
| 0.75 µl | 3.2mM SAM |
| 1 µl | MmeI |
Incubate at 37˚C for 1 hour. Inactivate enzyme at 65˚C for 20 minutes. Take a 0.5µL sample; label it 6. Drop-dialyze against ddH2O 20 mins.
- Linker 2 ligation:
| 10 µl | DNA (as much as possible) |
| 1 µl | Linker 2 (at ~58.8 pmol/µl; ~5 X molar ratio) |
| 11 µl | 2X Quick Ligation Buffer |
| 0.75 µl | Quick Ligase |
Incubate for 30 minutes at RT.
Add 5 volumes Zymo DNA Binding Buffer (110µL) and purify on a Zymo column (input is ~1.5µg). Elute in 8µL. Measure and recover a 0.5µL sample; label it 7.
- Linker1/MmeI site removal:
To the ~7µL recovered, add 1µL 10X Cutsmart and 1µL BsaXI. Incubate at 37˚C for 60 minutes.
Drop-dialyze samples against ddH2O, 20 minutes. Wash out dialysis drops with additional 5µL ddH2O. Take a 0.5µL sample and label it 8.
- Linker 3 ligation:
| Component | Quantity |
| DNA [e.g. 600ng = 11 pmol] | 13 µl |
| Linker 3 (at 38.1 pmol/µl, this is ~3.5 X molar ratio) | 1 µl |
| 2X Quick Ligation Buffer | 14 µl |
| Quick Ligase | 0.75 µl |
Add 150µL (5 volumes) Zymo DNA Binding Buffer. Purify over a column; elute in 10µL/column. Nanodrop and recover a 0.5µL sample; label it 9.
- PCR-amplification of ligation product:
| Component | Quantity |
| Ligation product | 2 µl |
| T7 fwd amplification oligo (0.5 µM final) | 1.25 µl |
| 3’ sgRNA constant region oligo (0.5 µM final) | 1.25 µl |
| 2X Q5 HotStart Master Mix | 12.5 µl |
| ddH2O | 8 µl |
| Step | Temperature | Duration | Times |
| 1 | 98 °C | 30 s | 1 |
| 2 | 98 °C | 10 s | 10 |
| 3 | 59 °C | 30 s | 10 |
| 4 | 72 °C | 30 s | 10 |
| 5 | 72 °C | 2 min | 1 |
| 6 | 12 °C | inf. |
- Label PCR product sample 10. Run gel to check library for presence of 136bp band (15% TBE-PAGE minigels)
- Add 20µL 10X DNA loading dye to ~22.5µL remaining PCR product. Run out entirety of PCR product across 4 lanes of a 10-well gel and stain 20 min with two drops of EtBr or (preferably) GelStar in 50mL buffer.
- Cut out 136bp band under UV or (preferably) blue light illuminator, place in 0.6mL tube. Crush gel slice and add 100µL Crush-and-soak buffer (1mM EDTA, 0.1% SDS, 0.3M NaAc 5.2). Incubate rotating overnight at room temperature.
- Spin through a 0.2 µm spin filter (3 min, max speed). Wash out incubation tube with 500µL Zymo DNA binding buffer and spin this through the same filter. Column-purify; elute in 20µL. If the end-point of ligation of guides into a vector, steps 26-27 may not be necessary.
- Repeat the PCR as step 21, scaled up to 3 x 50µL reactions and using 3µL template for each 50µL reaction for 12 cycles.
- Purify PCR products over Zymo column and measure concentration.
- Transcribe library using T7 RNA polymerase or phosphorylate and clone into a vector for propagation.
- Troubleshooting: Analyze numbered samples on 15% TBE-PAGE gel to determine presence of DNA, enzyme activity and ligase activity.