Single cell RNAseq from acute cortical slices
Introduction
Materials
- Sodium thiopental
- Cutting solution
- Choline chloride 110mM
- MgCl2 7mM
- Sodium ascorbate 11.6mM
- Sodium pyruvate 3.1mM
- KCl 2.5mM
- NaH2PO4 1.25mM
- CaCl2 0.5mM
- NaHCO3 25mM
- D-glucose 25mM
- ACSF
- NaCl 125mM
- KCl 2.5mM
- NaH2PO4 1.25mM
- NaHCO3 26mM
- D-glucose 4.8g/L
- CaCl2 1mM
- MgCl 2mM
- Pipette internal solution
- KCl 5mM
- Potassium gluconate 115mM
- HEPES 10mM
- Mg-ATP 4mM
- Na-GTP 0.3mM
- Sodium phosphocreatine 10mM
- RNAseOUT 2U/µL
- Smart-seq2 lysis buffer (in each PCR tube)
- RNAseOUT 4U
- 0.2% Triton X-100, 2.4µL
- dNTP mix 10mM, 1µL
- ERCC spike-ins, 1:500,000 dilution, 0.1µL
- Smart-seq2 oligo dT 5'–AAGCAGTGGTATCAACGCAGAGTACT30VN-3' 10mM, 1µL
- Glass capillaries, baked at 200 C for 2 hours
- Smart-seq2 RT master mix (per sample)
- SuperScript II 5X FS bufffer, 2µL
- DTT 100mM, 0.5µL
- Betaine 5M, 2µL
- MgCl2 1M, 0.1µL
- RNAseOUT, 0.25µL
- SuperScript II Reverse Transcriptase, 0.5µL
- Template switching oligo 5′-AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3 10µM, 1µL
- PCR master mix (per sample)
- KAPA HiFi HotStart Ready Mix 2x, 12.5µL
- Nuclease-free water, 2.3µL
- ISPCR primers 5′-AAGCAGTGGTATCAACGCAGAGT-3′ 10µM, 0.2µL
Procedure
Prepare brain slices
Follow your favourite slicing protocol. This is what I do.
- Deeply anaesthetize the mouse thiopental.
- OPTIONAL If the mouse is over 40 days old, perfuse transcardially with 5mL ice cold bubbled ACSF.
- Extract the brain and place in the vibratome in ice cold bubbled cutting solution.
- Cut 350 um slices of the region of interest.
- For each slice, briefly rinse in bubbled room temperature ACSF, then incubate in bubbled ACSF at 34 C for 30 min.
- Afterwards, keep slices in bubbled ACSF at RT.
Collecting cells
I typically carry on with cell collection for 6-8 hours after slicing.
- Transfer a slice to the microscope and perfuse with bubbled ACSF at RT
- Load a freshly pulled pipette with internal solution, apply positive pressure and inspect the tip under the microscope. Typically, I go for 3-4 um diameter, or 1-2 MOhm.
- Approach the cell of interest with positive pressure, then apply negative pressure and monitor the aspiration. If possible, acquire video of the process for future reference.
- Once the cell is harvested, withdraw the pipette and break the pipette tip against the bottom of a PCR tube containing Smart-seq2 lysis buffer.
CRITICALPull the pipette out of the lysis buffer quickly to avoid drawing the lysis buffer into it by capillary action.
- Immediately freeze the tube on dry ice or at -80 C.
PAUSESamples can be stored at -80 C for several weeks.
Smart-seq2 RT and preamp
- Prepare Smart-seq2 RT master mix.
- Take samples from the -80 and incubate at 72 C for 3 min in a thermocycler, then place on ice immediately.
CRITICALPlacing samples on ice reduces secondary structure formation.
- With the samples on ice, add 6.35µL of the Smart-seq2 RT master mix. Do not pipette up and down.
- Briefly spin the samples down.
- Run the RT reaction in a thermocycler: 42 C for 90 min, then 10 cycles of 50 C for 2 min and 42 C for 2 min, followed by 70 C for 15 min.
Allegedly cycling at 50/42 C can be skipped when in a rush without a substantial loss of yield. However, this may introduce a bias against transcripts with secondary structure.
PAUSEcDNA can remain in the thermocycler over night at 10 C.
- Add 15µL of the PCR master mix to each sample.
- Run PCR preamp: 98 C for 3 min, then 20 cycles of 98 C for 20 s, 67 C for 15 s, 72 C for 6 minc, followed by 72 C for 5 min.
Because some of the RNA is lost in the aspiration procedure (remaining stuck to the glass?), I increased the number of cycles compared with the published Smart-seq2 protocol. These parameters typically yield 1ng/µL of amplified cDNA for good samples.
- Purify with 20µL of AMPure XP beads, eluting in 15µL of elution buffer (10mM Tris-HCl, pH 8.5). Water is fine too.
- OPTIONAL Check the yield by running 1µL of the sample on a DNA HS chip.
PAUSEPurified cDNA can be stored at -20 C for all eternity.
- Proceed to Nextera XT library prep. If not checking the yield, 1µL of the sample usually works.
This is what I am doing so far. The Smart-seq2 preamp is as described in http://www.nature.com/nprot/journal/v9/n1/full/nprot.2014.006.html unless otherwise noted. Set aside a clean area for pre-PCR steps. I do these steps in a flow hood but that's overkill. Clean regularly with RNAseZap and 1% hypochlorite bleach or DNAZap to prevent DNA contamination. Change gloves frequently. Open questions: could a different internal solution improve yield? How to prevent or wash off RNA sticking to the glass?