sgRNA plasmid cloning

Materials

  • T4 DNA ligase buffer (NEB)
    • T4 Polynucleotide Kinase (NEB)
      • Q5 Hot Start High-Fidelity 2X Master Mix (NEB)
        • DpnI (20U, NEB)
          • Buffer PB (Qiagen)
            • QIAprep spin column Qiagen)
              • DNA Wash Buffer (Omega Bio-tek)
                • Buffer EB (Qiagen)
                  • 2X QuickLigase Buffer (NEB)
                    • QuickLigase (NEB)
                      • pFYFsgRNA plasmid

                        Part 1: 5' phosphorylate both primers

                        1. Example set of primers to use for cloning. The 20 nt highlighted in green should be altered according to your protospacer sequence.

                        Universal reverse primer: GGTGTTTCGTCCTTTCCACAAG

                        EMX1 forward: GAGTCCGAGCAGAAGAAGAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC

                        1. Combine the following components:
                        ReagentVolume (uL)
                        T4 DNA ligase buffer2
                        Primer (100 uM stock solution)2
                        H2O15
                        T4 Polynucleotide Kinase1
                        Total20
                        1. Incubate at 37°C for 20 m, heat inactivate at 95°C for 5 m.

                        Part 2: Perform PCR with phosphorylated primers

                        1. Combine the following components:
                        ReagentVolume (uL)
                        Q5 Hot Start High-Fidelity 2X Master Mix25
                        Forward primer (10 μM stock solution, from Part 1)2.5
                        Reverse primer (10 μM stock solution, from part 1)2.5
                        pFYFsgRNA plasmid as template (50-200 ng/uL conc.)1
                        H2O19
                        Total50
                        1. PCR was performed according to the manufacturer’s instructions, using 67°C as an annealing temperature and a 50 s extension time.
                        1. Incubate the PCR product with DpnI at 37°C for 1 h.

                        Part 3: Purify PCR products

                        1. Combine 50µL PCR reaction mixture with 250µL Buffer PB
                        1. Load onto QIAprep spin column
                        1. Rinse with 750µL DNA Wash Buffer
                        1. Elute with 50µL Buffer EB

                        Part 4: Ligate the PCR products

                        1. Combine the following coponents
                        ReagentVolume (uL)
                        PCR product from Part 31
                        H2O3
                        2X QuickLigase Buffer5
                        QuickLigase1
                        Total10
                        1. Incubate at ambient temperature for 15 min.

                        Part 5: Transform the ligated product into competent cells of choice.

                        1. Transform 5 μL of the reaction solution into competent cells of choice.
                        Benchling
                        Learn More
                        Contact
                        • Contact Us
                        • 680 Folsom St, 8th Floor
                          San Francisco, CA 94107
                        Legal

                        Benchling is actively tested against the latest versions of Chrome, Firefox, Safari, and Edge. It doesn't look like your current browser is supported - for more information, click here.