Universal reverse primer: GGTGTTTCGTCCTTTCCACAAG
EMX1 forward: GAGTCCGAGCAGAAGAAGAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC
A A | B B | |
1 1 | Reagent | Volume (uL) |
2 2 | T4 DNA ligase buffer | 2 |
3 3 | Primer (100 uM stock solution) | 2 |
4 4 | H2O | 15 |
5 5 | T4 Polynucleotide Kinase | 1 |
6 6 | Total | 20 |
A A | B B | |
1 1 | Reagent | Volume (uL) |
2 2 | Q5 Hot Start High-Fidelity 2X Master Mix | 25 |
3 3 | Forward primer (10 μM stock solution, from Part 1) | 2.5 |
4 4 | Reverse primer (10 μM stock solution, from part 1) | 2.5 |
5 5 | pFYFsgRNA plasmid as template (50-200 ng/uL conc.) | 1 |
6 6 | H2O | 19 |
7 7 | Total | 50 |
A A | B B | |
1 1 | Reagent | Volume (uL) |
2 2 | PCR product from Part 3 | 1 |
3 3 | H2O | 3 |
4 4 | 2X QuickLigase Buffer | 5 |
5 5 | QuickLigase | 1 |
6 6 | Total | 10 |
Benchling is actively tested against the latest versions of Chrome, Firefox, Safari, and Edge. It doesn't look like your current browser is supported - for more information, click here.
Written by Alexis Komor from David Liu's lab.