Welcome to Benchling

Benchling is an intelligent research platform with tools for note-taking, molecular biology, and sample tracking.

Create an account

Email
Already have an account?
Benchling is actively tested against the latest versions of Chrome, Firefox, Safari, and Edge. **It doesn't look like your current browser is supported** - for more information, [click here](/browsers).
Monospace normal
Monospace bold
0 of 0
Advanced Settings
    nCov QUASAR-lamp primers design
    • Notes
    • Metadata
    • Relevant Items
    • Single-temperature Double Digest
    • In vitro transcription of guide RNAs
    Editing disabled on read-only entry.

     
    nCov QUASAR-lamp primers design

    Wednesday, 3/25/2020Table1covid19NseqsMAMMOTH_Ngenelamp.pdfTable2image.pngimage.png
    Wednesday, 3/25/2020
    Starting with the 'Mammoth protocol' [1] primers for the N gene:
    This shows how these oligo sequences fit in the N gene for isothermal amp (to be confirmed!):
    covid19NseqsMAMMOTH_Ngenelamp.pdf
    [NOTE] Why N gene primers instead of E gene primers?
    E gene primers designed in the Mammoth protocol are nonspecific for SARS-CoV, bat-SARS-like-CoV, and SARS-CoV-2 coronaviruses, while their N gene primers are specific for SARS-CoV-2 coronaviruses [1].
    Haipin analysis
    [NOTE] We checked the primer/dimers etc with ThermoFischer's Multiple Primer Analyzer [3]. The N set of Mammoth primers seemed a bit better for Quasar-Lamp than the N set from Zhang et al... (FAM tag side open and available for quencher primer binding.)
    We also started checking for secondary structures (Hairpins) in the primersFIP and BIP. Such structures could make the primers hybridize with themselves instead of hybridizing with the quencher.
    We used the following standard lamp condition in the IDT oligo tools [2]:
    The results are:
    N-gene FIP
    image.png
    Loading...
    Loading...
    N-gene BIP
    image.png
    Loading...
    Loading...
    [NOTE] Why don't we use the LF and LB primers?
    These primers are the loop primers, used in lamp for speeding up the reaction. The concentration of these primers is lower than other ones in the reaction, so the fluorescence will be lower. If it's needed because the other primers form strong hairpins, we could still use these for this method (but not the F3/B3 primers!)
    We chose the BIP primer as it is the one with less stable hairpins, regarding the ΔG and Tm parameters.
    In this experiment fluorescein is being chosen to work as the primer dye, because is a relatively affordable and quite reliable. Cy5 is another possible tag.
    5'-3' FAM-BIP /56-FAM/CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG
    Quencher design
    10 nucleotides, complementary to the 5' BIP primer end, were used for the complementary quenching probe. The Tm should be be significantly lower than 65ºC (at least 5ºC lower). Iowa Black Fluorescein Quencher was elected as the quencher on the 3' end.
    5'-3' BIPc-IABkFQ TGCCAATGCG/3IABkFQ/
    References
    [1] J. P. Broughton​, W. Deng​, C. L. Fasching​, J. Singh​, C. Y. Chiu​, and J. S. Chen​, “A protocol for rapid detection of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR.”
    [2] Integrated DNA Technologies, “OligoAnalyzer Tool - primer analysis” [Online]. Available: https://eu.idtdna.com/pages/tools/oligoanalyzer. [Accessed: 25-Mar-2020].
    [3] Thermo Fisher Scientific, “Multiple Primer Analyzer.” [Online]. Available: https://www.thermofisher.com/es/es/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/multiple-primer-analyzer.html. [Accessed: 25-Mar-2020].
    [4] Zhang et al 'colorimetric' lamp for Covid19 https://www.medrxiv.org/content/10.1101/2020.02.26.20028373v1.full.pdf

    Welcome to Benchling!

    Sign in to view data.

    Split Workspace