Welcome to Benchling!

You're looking at a Protocol. Here are some things you can do with it:

Capture context, materials, and steps

  1. Document a list of materials.
  2. Add individual steps in the protocol.
  3. Add timers directly within your protocol.

Create protocol repositories for your lab

Insert tables with calculations

Attach protocols to Notebook entries

Create account

Sign up with GoogleI already have an account
Benchling is actively tested against the latest versions of Chrome, Firefox, Safari, and Edge. **It doesn't look like your current browser is supported** - for more information, [click here](/browsers).
Monospace normal
Monospace bold
0 of 0
Advanced Settings
    Amplification of Linearized Plasmid Backbone (pSB1C3)
    • Protocol
    • Relevant Items
    • Metadata
    Editing disabled on read-only protocol.

    Amplification of Linearized Plasmid Backbone (pSB1C3)

    Introduction

    This protocol can be used to prepare Linearized Plasmid Backbones of pSB1C3 or other iGEM plasmids for the purpose of use in cloning (such as Gibson Assembly). It is adapted from https://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones for use in the Biochemistry lab with our reagents. This protocol works with other iGEM backbone plasmids, such as pSB1A2, etc.

    Materials

    • Q5 High Fidelity 2X PCR Mix
      • SB-prep-3P-1 Primer, 10uM working stock
        • gccgctgcagtccggcaaaaaa
        • Prepare master stock as 100uM by resuspending in dH20 - 10X the amount of nmol present.
      • SB-prep-2Ea, 10uM working stock
        • atgaattccagaaatcatccttagcg
        • Prepare master stock as 100uM by resuspending in dH20 - 10X the amount of nmol present.
      • BBa_J04450 template (5ng/uL is preferred)

        Procedure

        • PCR Reaction Setup
        1. Add 2.1uL of each primer, 0.5uL of the DNA template, and 15.8uL of ddH20 to a PCR tube
        1. Add 25uL of Q5 mix
        1. Repeat if additional vector is required (setup several tubes in tandem.)
        • PCR Cyclying Conditions
        1. 94C/2min
        1. 94C/30s
        1. 55C/30s
        1. 68C/3min
        1. Repeat cycle (steps 2 to 4, 35 more times)
        1. 68C/10min
        1. Digest with DpnI enzyme: 2ul in 100ul reaction, incubate 37C/hour; heat kill 80C/20min
        1. If desired, purify the PCR product using the appropriate spin column kit.

        Welcome to Benchling!

        Sign in to view data.

        Split Workspace