Welcome to Benchling!

You're looking at a Protocol. Here are some things you can do with it:

Capture context, materials, and steps

  1. Document a list of materials.
  2. Add individual steps in the protocol.
  3. Add timers directly within your protocol.

Create protocol repositories for your lab

Insert tables with calculations

Attach protocols to Notebook entries

Create account

Sign up with GoogleI already have an account
Benchling is actively tested against the latest versions of Chrome, Firefox, Safari, and Edge. **It doesn't look like your current browser is supported** - for more information, [click here](/browsers).
Monospace normal
Monospace bold
0 of 0
Advanced Settings
    Protocol 016 - TBXT EMSA assay
    • Protocol
    • Relevant Items
    • Metadata
    Editing disabled on read-only protocol.

    Protocol 016 - TBXT EMSA assay

    Introduction

    Electrophoretic mobility shift assay (EMSA) to measure Brachyury-DNA interactions. This assay was adapted from the adapted from the Structural Genomics Consortium protocol in the TBXT TEP.

    Materials

    Procedure

    • Brachyury EMSA assay
    1. Prepare buffers (10mL)
    • Annealing buffer
    • 10 mM HEPES pH 7.5
    • 50 mM NaCl
    • EMSA Buffer
    • 25 mM HEPES pH 7.5
    • 75 mM NaCl
    • 0.1% Tween-20
    • 10% glycerol
    • 1 mM TCEP
    1. Dilute each DNA oligo (50-mers) to 100 uM in sterile dH20
    • T-binding sequence
    • Forward: CATGCATGCAGGGAATTTCACACCTAGGTGTGAAATTCCCATTCGTGCGA
    • Reverse: TCGCACGAATGGGAATTTCACACCTAGGTGTGAAATTCCCTGCATGCATG
    • Scrambled T-binding sequence
    • Forward: GATGTCGATACGACATCACTTAACCGTGAACGGGGTATCCACTTACGTTG
    • Reverse: CAACGTAAGTGGATACCCCGTTCACGGTTAAGTGATGTCGTATCGACATC
    1. Dilute 200 nM oligo pairs in Annealing Buffer
    Oligonucleotide Annealing Reaction
    Collapse table
    A
    B
     
    		ComponentVolume
     
    		10 uM Forward oligonucleotide4.0 uL
     
    		10 uM Reverse oligonucleotide4.0 uL
     
    		Annealing buffer192.0 uL
    • a. Incubate oligos at 95C for 10 min
    • b. Let cool to 25C on bench for 20 min
    1. Incubate purified Brachyury with annealed oligos in EMSA buffer
    • a. Dilute Brachyury to 1 uM in gel filtration buffer (50 mM HEPES pH 7.5, 500 mM NaCl, 5% glycerol, 1 mM TCEP)
    • b. Serially dilute two-fold in gel filtration buffer
    • c. Prepare reactions with 5 nM annealed oligos and brachyury serial dilutions in EMSA buffer
    Protein-DNA binding reaction
    Collapse table
    A
    B
     
    		ComponentVolume
     
    		Annealed oligos0.5 uL
     
    		Brachyury dilution5 uL
     
    		EMSA bufferto 20 uL total
     
    • c. Mix reaction by flicking gently, spin 5 sec
    • d. Incubate reaction at 25C for 20 min
    1. Pre-run a 3-8% Tris-Acetate gel in 0.5x TAE buffer at 75V for 30 min
    • a. This can be performed prior to setting up binding reaction
    1. Run the entire DNA-protein reaction on the pre-run gel in 0.5x TAE buffer
    • a. Add 4 uL 6x DNA loading dye to the reaction, mix thoroughly
    • b. Load the entire sample (24 uL)
    • c. Run the gel in 0.5x TAE buffer at 150V for 75 min
    • d. Remove the gel from the base
    • e. Stain the gel with SYBR Green (1:10,000) diluted in 0.5x TAE - 15 min at 25C on rocker
    • f. Wash the gel twice with dH20
    • g. Acquire image on the iBright Imaging system

    Welcome to Benchling!

    Sign in to view data.

    Split Workspace